Cytoplasmic mRNA Polyadenylation and Translation Assays Maria Piqu Jos Manuel Lpez and Ral Mndez

Summary

Vertebrate development is directed by maternally inherited messenger RNAs that are synthesized during the very long period of oogenesis. These dormant mRNAs usually contain short poly(A) tails and are stored as mRNA ribonucleoproteins that preclude riboso-mal recruitment. In Xenopus laevis oocytes treated with the meiosis-inducing hormone progesterone, their poly(A) tails are elongated, and the mRNAs are mobilized into polysomes. This cytoplasmic polyadenylation is directed by cis-acting elements located in the 3' untranslated region of the mRNAs. However, the cytoplasmic polyadenylation of all the maternal mRNAs does not take place at once, but rather the translational activation of specific mRNAs is regulated in a sequential manner during meiosis and early development. This chapter describes the use of microinjected reporter mRNAs and radiolabeled RNAs into Xenopus oocytes to study the mRNA translational control by cytoplasmic polyadenylation. Cyclin B1 mRNA is used to illustrate the methods described.

Key Words: CPEB; cyclin B1; cytoplasmic polyadenylation; translational control; 3'-UTR; Xenopus oocytes.

1. Introduction

The role of the 3' untranslated regions (3'-UTRs) of specific messenger RNAs (mRNAs) in the regulation of the poly(A) tail length and translation has been known for over 20 yr (for a review, see ref. 1 and references therein), but only recently have we begun to unveil the molecular mechanism governing this particular system of controlling gene expression. Most of our current understanding of cytoplasmic polyadenylation is derived from experiments performed in Xenopus oocytes, not only because this is a prominent mechanism in the control of maternal gene expression during meiosis and early development (2-5), but also because of the many technical advantages offered by Xenopus oocytes. The knowledge acquired in Xenopus oocytes has then been extrapolated to other systems, including oocytes from other species (6-10) and nongerm cells, such as neurons (11,12).

Fully grown oocytes (stage VI) are arrested at prophase I until progesterone induces resumption of meiosis (oocyte maturation). Maturation ends at metaphase II, when the

From: Methods in Molecular Biology, vol. 322: Xenopus Protocols: Cell Biology and Signal Transduction Edited by: X. J. Liu © Humana Press Inc., Totowa, NJ

oocytes await fertilization before they can complete the final meiotic division and initiate the embryonic cell divisions.

Cytoplasmic polyadenylation and subsequent translational activation of maternal mRNAs is required in at least two steps during meiotic progression (13-18). First, at prophase I when Mos mRNA, and probably other as-yet-unidentified mRNAs (19), have to be translationally activated for the oocyte to enter metaphase I. Then, progression from metaphase I to metaphase II requires the cytoplasmic polyadenylation of a different subset of mRNAs, of which cyclin B1 is the best-characterized example (reviewed in ref. 2). These two events allowed discrimination between early (or Mos-and Cdc2-independent) and late (or Mos- and Cdc2-dependent) cytoplasmic polyadenylation (20-22).

Mos, cyclin B1, and several other dormant mRNAs in oocytes contain short poly(A) tails (~20-40 nucleotides), and it is only when these tails are elongated (to ~150 nucleotides) that translation takes place. Polyadenylation requires two elements in the 3'-UTR, the hexanucleotide AAUAAA and the nearby cytoplasmic polyadenylation element (CPE), which recruits the CPE-binding protein (CPEB). The induction of poly-adenylation by this protein is regulated by two sequential phosphorylation events. First, the kinase Eg2 increases the affinity of CPEB for cleavage and polyadenylation specificity factor (CPSF) and mediates Mos polyadenylation (23,24); subsequently, Cdc2 induces hyperphosphorylation and partial degradation of CPEB and is required for cyclin B1 polyadenylation (22).

Prior to polyadenylation, the CPE-containing mRNAs, or at least some of them, are actively silenced by CPEB (25,26) through its interaction with another inhibitory protein called Maskin. Together, they block the cap-binding translation initiation factor eIF4E, preventing the recruitment of the small ribosomal subunit (27). Elongation of the poly(A) tail is both required and sufficient to release the Maskin-mediated transla-tional repression (28).

A number of mRNAs have been shown to undergo translational control by cyto-plasmic polyadenylation in both oocytes and embryos. Most of the examples correspond to mRNAs polyadenylated in oocytes in response to progesterone. From these, the consensus for CPE in Xenopus oocytes is derived as U4A1-2U, although alternative sequences can also be found. The CPE should be located close to the hexanucleotide, but it seems to admit a wide range of positions, from overlapping up to a distance of 100 nucleotides and even further if there is secondary structure in the 3'-UTR that effectively positions the CPE in the proximity of the hexanucleotide.

Different methods to analyze the poly(A) tail length of endogenous or injected mRNAs have been developed (29,30). Xenopus oocytes, in which RNA reporters can be injected into the cytoplasm, provide an ideal system to study cytoplasmic polyadenylation. By this method, it is possible to measure the functionality of any 3'-UTR in mediating translational repression and activation in response to progesterone, as well as cytoplasmic changes in the length of the poly(A) tail. Moreover, the use of exogenous transcripts means that variants can be generated to better define the functional elements in the 3'-UTR under study. Although this method is obviously best suited to study maternal Xenopus mRNAs, it has been successfully used to ana lyze the potential regulation of heterologous 3'-UTRs derived, for example, from neuronal mRNAs (11).

The study of the CPE-dependent translational repression, translational activation, and cytoplasmic polyadenylation mediated by the 3'-UTR of cyclin B1 mRNA is used to illustrate the methods described in this chapter.

2. Materials

2.1. DNA and RNA Manipulation

1. 6X DNA gel-loading buffer: 30% glycerol, 0.025% Orange G (Sigma).

2. Agarose gels in 1X TBE (see item 7) and 0.5 |lg/mL ethidium bromide.

3. Ethidium bromide solution (10 mg/mL) (Sigma); store protected from light.

4. Water-saturated phenol/chloroform/isoamyl alcohol (25/24/1).

5. Phenol/chloroform/isoamyl alcohol (25/24/1) saturated with 10 mM Tris-HCl, pH 8.0.

6. Diethyl pyrocarbonate (DEPC)-treated water: treat with 0.1% diethyl pyrocarbonate for at least 12 h at 37°C and autoclave twice.

7. 1X TBE: 90 mM Tris-borate and 2 mM ethylenediaminetetraacetic acid (EDTA), pH 8.3.

8. PAS buffer: 0.1 M Tris-HCl, 6% (w/v) ^-aminosalicylic acid (PAS), 1% sodium dodecyl sulfate (SDS), 1 mM EDTA, pH 7.6.

2.2. Oocyte Isolation, Injection, and Treatment

1. 10X Modified Barth's solution (MBS): 880 mM NaCl, 10 mM KCl, 10 mM MgSO4, 50 mM of N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid (HEPES), 25 mM NaHCO3. Adjust pH to 7.8 with NaOH. Autoclave.

2. 1X MBS: prepare the final 1X MBS from the 10X stock and supplement with CaCl2 to a 0.7 mM final concentration.

3. Progesterone (Sigma): prepare a 10 mM stock in 100% ethanol. Aliquot and store at -20°C.

4. Cycloheximide (Sigma): prepare a 100 mg/mL stock in 100% ethanol. Aliquot and store at -20°C.

5. Microinjection glass capillaries: 3.5 in. long, 0.53 mm internal diameter, and 1.14 mm external diameter (ref. 3-000-203-G/X, Drummond Scientific Co.).

6. Needle puller (model P-30, Sutter Instrument Co.).

7. Microinjector (automatic nanoliter injector, Nanoject II 2.3- to 96-nL variable volume, Drummond Scientific Co.).

2.3. Luciferase RNA Synthesis and Quantification

1. mMESSAGE mMACHINE kit (Ambion).

2. 2X RNA gel-loading buffer: 95% formamide, 18 mM EDTA, 0.025% SDS, 0.025% Orange G.

2.4. Dual-Luciferase Reporter Assay

1. Dual-Luciferase reporter assay kit (Promega).

2. Plate-reading luminometer equipped with two reagent injectors.

2.5. Synthesis of 32P-Labeled RNA

1. 5X Transcription buffer: 200 mM Tris-HCl, pH 7.9, 30 mM MgCl2, 50 mM dithiothreitol, 50 mM NaCl, and 10 mM spermidine (MBI Fermentas).

2. 20 U/|L Ribonuclease (RNase) inhibitor (MBI Fermentas).

4. 800 Ci/mmol, 20 mCi/mL uridine 5'-[a-32P] triphosphate (a-[32P]-UTP; Amersham Pharmacia Biotech).

5. 20 U/^L T3, T7, or Sp6 RNA polymerase (MBI Fermentas).

6. 10X Ribonucleotide 5'triphosphate mix: 5 mM adenosine 5'-triphosphate (ATP), 5 mM cyti-dine 5'-triphosphate (CTP), 1 mM uridine 5'-triphosphate (UTP), 0.5 mM guanosine 5'-triphosphate (GTP).

7. 2X RNA gel-loading buffer: 95% formamide, 18 mM EDTA, 0.025% SDS, 0.025% xylene cyanol, 0.025% bromophenol blue.

2.6. Denaturing Polyacrylamide Gel Electrophoresis

1. 40% Acrylamide solution (acryl/bis = 37.5/1) (BioRad).

2. 10% Ammonium persulfate. Store at 4°C protected from light.

3. 6% Polyacrylamide/8M urea gel solution in 1X TBE; store protected from light.

2.7. Oligonucleotides

1. T3Luc-s: GGAATTAACCCTCACTAAAGGGGGCCAAGAAGGGCGGAAAGTC

2. B1-as: CCGGATCCGCTTTATTAAAACCAGTAAAACATTAAAAACAC

3. B1(-CPE)-as: CCGGATCCGCTTTATTccAACCAGTccAACATcccAAACAC

4. c-mos antisense: TGGACATTGAGATACTGTACTAGAT

The T3Luc-s oligonucleotide contains the T3 promoter (nucleotides 3-22 of the primer) and a sequence matching the nucleotides 1670 to 1690 of the firefly luciferase Open Reading Frame (ORF; nucleotides 23-43 of the primer).

The B1-as oligonucleotide contains a sequence complementary to the 3'-UTR of Xenopus laevis cyclin B1 mRNA (nucleotides 1350-1382 of the Genbank accession number J03166; nucleotides 9-41 of the primer), and a BamHI restriction site (nucle-otides 3-8 of the primer).

The B1(-CPE)-as oligonucleotide contains a sequence partially complementary to the 3'-UTR of X. laevis cyclin B1 mRNA (nucleotides 1350-1382 of the Genbank accession number J03166; nucleotides 9-41 of the primer) with point mutations in the CPEs (indicated in lowercase) and a BamHI restriction site (nucleotides 3-8 of the primer).

The c-mos antisense oligonucleotide is complementary to a sequence in the 3'-UTR of X. laevis c-mos mRNA (nucleotides 2265-2289 of the Genbank accession number X13311).

3. Methods

Particular precautions are required when working with RNA to eliminate RNase contamination. Whenever possible, solutions should be autoclaved or filtered and made with DEPC-treated water. Glassware must be baked at 180°C, and Eppendorf tubes and pipet tips should be RNase free. Filter tips are recommended. Powder-free gloves should be worn for the transcription reactions and manipulation of RNA.

3.1. Analysis of the Translational Effect of 3 -UTRs

To determine how translation is regulated by a 3'-UTR, fusion mRNAs containing the ORF of firefly luciferase followed by the 3'-UTR (luc-3'UTR) under study are generated (see Fig. 1A). These mRNAs are injected into oocytes, and their translational efficiency is determined by measuring the luciferase activity in oocyte extracts.

Reference 3'-UTR plasmid

— T3 promoter —

Firefly luciferase ORF (1600 bp)

Y

Y

V

Kpn\

Pvull

Sspl

Drain

(470bp)

(470bp)

Normalizing plasmid

Normalizing plasmid

Fig. 1. (A) Schematic drawing of plasmids used for in vitro transcription. The arrows show positions of restriction sites used to linearize the plasmids. Positions of the T3 promoter, the firefly and Renilla luciferase Open Reading Frames (ORFs), the poly(A), and the inserted cyclin B1 3'-UTR are indicated. (B) Cyclin B1 3'-UTR-mediated translational repression and activation. Synthetic mRNAs containing luciferase coding sequences fused to the cyclin B1 3'-UTR (B1), cyclin B1 3'-UTR where the CPEs were rendered nonfunctional by point mutation [B1(-CPE)], cyclin B1 3'-UTR with a poly(A) tail [B1 poly(A)] or a control 3'-UTR of 53 nucleotides (reference 53) were coinjected with the Renilla luciferase normalizing mRNA. Oocytes were then incubated in the presence or absence of progesterone (Prog). The histogram plots the firefly/Renilla luciferase activity referred to the activity of the B1-mRNA.

Fig. 1. (A) Schematic drawing of plasmids used for in vitro transcription. The arrows show positions of restriction sites used to linearize the plasmids. Positions of the T3 promoter, the firefly and Renilla luciferase Open Reading Frames (ORFs), the poly(A), and the inserted cyclin B1 3'-UTR are indicated. (B) Cyclin B1 3'-UTR-mediated translational repression and activation. Synthetic mRNAs containing luciferase coding sequences fused to the cyclin B1 3'-UTR (B1), cyclin B1 3'-UTR where the CPEs were rendered nonfunctional by point mutation [B1(-CPE)], cyclin B1 3'-UTR with a poly(A) tail [B1 poly(A)] or a control 3'-UTR of 53 nucleotides (reference 53) were coinjected with the Renilla luciferase normalizing mRNA. Oocytes were then incubated in the presence or absence of progesterone (Prog). The histogram plots the firefly/Renilla luciferase activity referred to the activity of the B1-mRNA.

To obtain a reliable measurement of the translational regulation by the 3'-UTR, two critical controls are needed. First, the activity of each studied 3'-UTR is compared with a control 3'-UTR (reference 3'-UTR) of equal length because the size of the 3'-UTR has a clear effect on translation, and this effect has to be discriminated from the activation by polyadenylation (31). Second, to control for microinjection accuracy as well as any possible mRNA degradation during the manipulation or general changes on the translational rate of individual oocytes, the fusion mRNAs containing the luc-3'UTR and reference 3'-UTR are coinjected with identical amounts of an mRNA encoding for Renilla luciferase as a second reporter (normalizing RNA).

To better define the role of the poly(A) tail in the translational efficiency of the reporters, use pBluescript (pBSK)-derived plasmids containing a stretch of 73 adenines 3' of the inserted 3'-UTR (6). Thus, the luc-3'UTR RNAs can now be synthesized containing 73 adenines. This additional control defines the expected degree of translational activation for an mRNA that is cytoplasmically polyadenylated. In addition, it also determines whether the poly(A) elongation is the only event responsible for the stimulation by comparing the luciferase activity of the transcribed polyadenylated mRNA in the presence and absence of progesterone.

An additional step can be incorporated to this assay to identify the time at which the translational activation takes place, early or late (see Subheading 1.). Both events can be easily discriminated by preventing Mos synthesis with the microinjection of a mos antisense oligonucleotide (32) (see Note 1) and then performing the assay as described. The progesterone-induced translational activation of the "early mRNAs" is not affected by the mos antisense oligonucleotide, whereas the activation of the "late mRNAs" is blocked (20,21).

Although the injected mRNAs are very stable in stage VI Xenopus oocytes, we routinely performed Northern blot analysis to confirm stability. Extract the RNA as described in Subheading 3.2.3. and perform the Northern blot according to standard methods (33).

For the cyclin B1 3'-UTR, we generated two fusion mRNAs containing the firefly luciferase ORF followed by the cyclin B1 3'-UTR, either wild type (B1) or a variant in which all the putative CPEs were rendered nonfunctional by point mutations [B1(-CPE)]. By studying the translational effects of the B1 and B1(-CPE) 3'-UTRs in prophase-arrested stage VI oocytes, compared with their reference 3'-UTR (control, 53 nt), we determined the CPE-dependent translational repression mediated by this 3'-UTR. As shown in Fig. 1B, the cyclin B1 3'-UTR, but not the cyclin B1(-CPE) 3'-UTR induced a 4.5-fold translational repression. An indirect, but quantitative, measurement of the translational activation by cytoplasmic polyadenylation was obtained by comparing the translation of the B1 and B1(-CPE) mRNAs in the absence and presence of progesterone. The cyclin B1 3'-UTR induced a 30-fold increase in translational activation after progesterone addition, which was not observed for the cyclin B1(-CPE) 3'-UTR. Cyclin B1 3'UTR plus poly(A) [B1 poly(A)] mRNA was already fully active in prophase-arrested stage VI oocytes and was not further activated by progesterone.

The methods described next outline the generation of the DNA templates (Subheading 3.1.1.), in vitro transcription (runoff method) and mRNA quantification (Sub heading 3.1.2.), RNA injection in oocytes and induction of maturation (Subheading 3.1.3.), and dual-luciferase reporter assay (Subheading 3.1.4.).

3.1.1. Generation of the DNA Templates for In Vitro Transcription

Three different plasmids are required to study the translational effects of a 3'-UTR: the luc-3'UTR plasmid, the reference 3'-UTR plasmid, and the normalizing plasmid.

The luc-3'UTR plasmid construct contains, in sequential order, the phage polymerase T3 promoter (T7 or SP6 promoters can also be used), the firefly luciferase ORF, a multicloning site, and a poly(A) stretch of 73 nucleotides followed by a unique restriction site. The multicloning site is used for the directional cloning of the 3'-UTR under study and to linearize the plasmid 5' of the poly(A) tail. The unique restriction site allows the linearization of the plasmid to generate transcripts containing the poly(A) tail (see Fig. 1A). This plasmid was generated as follows: the ORF of the firefly luciferase was obtained by polymerase chain reaction (PCR), adding a SmaI restriction site at the 5' end and HpaI and BamHI restriction sites at the 3' end. The resulting PCR product was cloned into SmaI and BamHI sites of the pBSK plasmid containing a poly(A) track of 73 residues (PBSK-A) (6).

To generate the cyclin B1 3'-UTR plasmid, we PCR amplified the 67 nucleotides corresponding to positions 1316 to 1380 of the X. laevis cyclin B1 mRNA (Genbank accession number J03166) (B1 3'-UTR in Fig. 1A) or a variant with the putative CPEs mutated [B1(-CPE) 3'-UTR], that were cloned into HpaI and BamHI sites of the 3'-UTR plasmid (for details of the point mutations, see Subheading 2.7.).

The reference 3'-UTR plasmid construct contains, in sequential order, the T3 promoter, the firefly luciferase ORF, and a polylinker sequence that is used to linearize the plasmid at different positions. The transcription of these templates generates reference mRNAs with 3'-UTRs of different lengths (see Fig. 1A). This plasmid was generated by inserting the firefly luciferase ORF into the SacI and EcoRV sites of the pBSK plasmid.

The normalizing plasmid construct contains, in sequential order, the T3 promoter, the Renilla luciferase ORF, a poly(A) stretch of 73 nucleotides, and a unique restriction site (Ecl132 II) (see Fig. 1A). The transcription of this linearized DNA will generate the normalizing mRNA. This plasmid was obtained as follows: the ORF of the Renilla luciferase was obtained by PCR adding a SmaI restriction site at the 5' end and BglII, HpaI, and BamHI restriction sites at the 3' end. The resulting PCR product was cloned into SmaI and BamHI sites of the pBSK plasmid. The poly(A) track of 73 residues was inserted as described by Gebauer et al. (6).

All, the luc-3'UTR plasmid, the reference 3'-UTR plasmid and the normalizing plasmid are linearized in the appropriate restriction site (see Notes 2 and 3) and purified by phenol/chloroform/isoamyl alcohol extraction and isopropanol precipitation (33).

3.1.2. In Vitro Transcription (Runoff Method) and mRNA Quantification

Although the method described in Subheading 3.2.2. can also be used for transcription of long 5'-capped mRNAs in vitro, a much better yield is obtained using commercial kits, such as the mMESSAGE mMACHINE (Ambion). If the assay from Subheading 3.2.2. is performed, increase the final UTP concentration to 0.5 mM and the linearized DNA template to 1 ^g. Scale up the reaction as needed.

Comparison of the translational efficiency of different transcripts requires accurate measurement of the concentration and integrity of the mRNAs. This step should be performed prior to each round of injections. An approximate measurement of the RNA concentration can be derived from the optical density (OD) at 260 nm, where 1 absorption unit equals 40 |g/mL for single-stranded RNA (see Note 4). Typically, a 1/100 dilution of the transcription reaction will give an absorbance reading in the linear range of the spectrophotometer. However, any unincorporated nucleotide or partially degraded RNA or template DNA in the mixture will interfere with the measurement (see Note 5).

A more accurate determination of the concentration and integrity of the transcripts can be obtained by running the RNA samples in an agarose gel with ethidium bromide and quantifying the intensity of the bands. A normal 1X TBE gel is sufficient, although a formamide-loading buffer should be used and the samples heat denatured. This method is as accurate as the quantification by trace radiolabeling, with the additional advantage that the ratio of full transcript to partial products is also obtained (see Note 6).

1. Prepare a 2% agarose gel in 1X TBE and prerun it for 10 min at 9 V/cm to maintain the heated system, thus avoiding RNA renaturalization during electrophoresis. Denaturing gels with 1X MOPS and 10% formaldehyde may be run if secondary structures are a problem (see Note 7).

2. Dilute 1/20 each RNA sample (to approx 50-100 ng/|L) and mix 3 ||L of the dilutions with 3 |L of gel-loading buffer. Heat to 70°C for 5 to 10 min (see Note 8).

3. Load the RNAs under study and an RNA marker of known concentration as standard.

4. Run the gel for 10 min at 9 V/cm. Longer running times may result in the formation of secondary structures.

5. Photograph the gel using short-wavelength ultraviolet irradiation. Compare the intensity of fluorescence of the unknown RNA with that of the RNA standard and calculate the quantity of RNA in the samples (usually between 50 and 100 ng/|L). An image analysis system, such as the Gel Doc 2000 hardware and the Quantity One software package (BioRad), will facilitate this step.

6. Make the firefly/'Renilla mRNAs mix so the final concentration of each one is 30 ng/|L. Check and verify this mixture by running an aliquot (5 |L) in a 2% agarose gel (as described in steps 1-5).

3.1.3. RNA Injection in Oocytes and Induction of Maturation

For a detailed protocol of the isolation of Xenopus oocytes, see Chapter 3, this volume, and refs. 34 to 36. We use 0.8 mg/mL collagenase and 0.48 mg/mL dispase II instead of collagenase alone to dissociate oocytes from follicles (see Note 9).

Although cytoplasmic polyadenylation seems to tolerate large quantities of substrate, the CPEB-mediated translational repression is overridden by the injection of more than 0.1 fmol of RNA per oocyte (25,26). Larger quantities of mRNA could competitively inhibit global translation and even prevent maturation. Injection of mRNAs in the order of 0.01 fmol produces enough luciferase activity that can be detected within the linear range (see Fig. 2A,B), ensuring that the limited masking capability of the oocytes is not overwhelmed.

Fig. 2. Determination of the linear range of firefly and Renilla luciferase activities. Xenopus oocytes were coinjected with the luciferase/cyclin B1 3'-UTR fusion mRNA and the Renilla luciferase normalizing mRNA. Oocytes were then treated with progesterone, and luciferase activity was determined as described in Subheadings 3.1.5. and 3.1.6. Panels display the (A) firefly and (B) Renilla relative luminescence units (RLU) as a function of extract volume. (C) Time-course of luciferase accumulation. The firefly luciferase mRNAs containing or not containing a 73-residue poly(A) [Luc poly(A) or (Luc), respectively] were coinjected with the Renilla normalizing mRNA. The oocytes were collected at the indicated times, and the luciferase activities were determined. The firefly/'Renilla luciferase activity is plotted as a function of the incubation time, and the results are expressed as the percentage of the value at 2 h.

Fig. 2. Determination of the linear range of firefly and Renilla luciferase activities. Xenopus oocytes were coinjected with the luciferase/cyclin B1 3'-UTR fusion mRNA and the Renilla luciferase normalizing mRNA. Oocytes were then treated with progesterone, and luciferase activity was determined as described in Subheadings 3.1.5. and 3.1.6. Panels display the (A) firefly and (B) Renilla relative luminescence units (RLU) as a function of extract volume. (C) Time-course of luciferase accumulation. The firefly luciferase mRNAs containing or not containing a 73-residue poly(A) [Luc poly(A) or (Luc), respectively] were coinjected with the Renilla normalizing mRNA. The oocytes were collected at the indicated times, and the luciferase activities were determined. The firefly/'Renilla luciferase activity is plotted as a function of the incubation time, and the results are expressed as the percentage of the value at 2 h.

1. Prepare a fresh 1/66 dilution of each firefly/'Renilla RNA mixture (0.5 ng/|L). Heat the RNA samples to eliminate secondary structures and keep them on ice during the course of injection (see Note 10).

2. Prepare the microinjection needles from glass capillaries by setting the controls of the needle vertical puller at 750 for heat 1 and at 860 for the puller (see Note 11).

3. Backfill the needle with mineral oil using a syringe. Hold the needle with the micromanipulator at 45°. Break the needle tip with forceps to a diameter of approx 10 |m. Front-fill the needle with 1 to 2 | L of the RNA sample, avoiding the formation of air bubbles.

4. Set the automatic microinjector so that 27 nL/oocyte (0.025 fmol RNA/oocyte) is injected in fast-speed mode.

5. For each firefly/Renilla RNA mixture, inject 20 to 30 oocytes. The injection should be made in the middle equatorial line of the oocyte, avoiding the nucleus.

6. Separate the injected oocytes in two pools in glass dishes with 5 mL of 1X MBS. Add progesterone (10 |lM) to one of the pools (see Note 12).

7. Incubate the oocytes at 20°C. Check periodically and discard the unhealthy oocytes. Although the exact time of incubation varies according to the design of the experiment and the maturation rate of the oocytes, within 2 h luciferase activity reaches the steady state (see Fig. 2C). When analyzing the effect of progesterone, use oocytes synchronized for maturation (detected by the appearance of a white spot in the animal pole); usually more than 90% of the oocytes mature.

8. Collect the oocytes. Remove as much 1X MBS as possible and freeze the tubes in dry ice. At this step, the samples can be stored for several days at -80°C.

3.1.4. Dual-Luciferase Reporter Assay

In the dual-luciferase reporter assay, the activities of both firefly (Photinus pyralis) and Renilla (Renilla reniformis) luciferases are measured sequentially from the same sample. Each luciferase catalyzes a bioluminescent reaction with different substrate specificity, allowing for a clear discrimination between their expression levels. The levels of detection for each experimental condition should be determined to define the lower concentration of injected mRNA that results in a luciferase signal within the linear range (see Fig. 2A,B). For B1 and B1(-CPE) mRNAs, the assay was performed using the dual-luciferase reporter assay system of Promega and a plate-reading luminometer equipped with two reagent injectors and a computer for direct capture of data output.

1. Lysate the oocytes by adding 10 |L/oocyte of 1X passive lysis buffer and pipeting up and down through a 200-|L tip. Clear the samples by centrifugation at 16,000g for 15 min at 4°C. Collect the middle layer and discard the upper phase containing the lipids and yolk, as well as the pellet with the pigment granules. Perform this step on ice (see Note 13).

2. Dispense a 10-|L aliquot of each cytoplasmic extract into an opaque 96-well plate and read in the luminometer programmed as follows:

a. Inject 50 |L of luciferase assay reagent II.

b. Measure firefly luciferase activity for 10 s after a delay of 2.05 s.

d. Measure Renilla luciferase activity for 10 s.

3.2. Analysis of Changes in RNA Polyadenylation

This method allows the direct visualization of cytoplasmic poly(A) addition to small RNA probes. Radiolabeled RNAs containing the 3'-UTRs of interest are generated by in vitro transcription in the presence of a-[32P]-UTP. Then, the RNAs are micro-injected in the cytoplasm, and the oocytes are incubated in the presence or absence of progesterone. Following the treatment, total RNA is extracted and resolved by poly-acrylamide-urea gel electrophoresis, and the RNA probes are visualized by autorad-iography. The polyadenylated RNAs will display slower gel mobility and a more heterogeneous size than the nonpolyadenylated RNAs (see Fig. 3).

In addition, to test whether the polyadenylation of the injected RNA probe is an "early" or a "late" event (see Subheadings 1. and 3.1.), the protein synthesis inhibitor

Fig. 3. Cyclin B1 polyadenylation. Labeled RNAs derived from wild-type (B1) and CPE-mutated [B1(-CPE)] cyclin B1 3'-UTR were assayed for poly(A) addition, as described in Subheading 3.2.

cycloheximide may be used to prevent Mos synthesis. The oocytes injected with the labeled RNAs should be incubated in the presence of 100 ^g/mL cycloheximide for 1 h prior to the addition of progesterone. Note that oocytes treated with cycloheximide fail to undergo germinal vesicle breakdown.

The maximum recommended length of the RNA transcripts for this assay is 300 nucleotides (see Note 14).

To analyze whether the cyclin B1 3'-UTR was a target for CPE-dependent cytoplasmic polyadenylation, small RNAs containing either the wild-type (B1) or a mutant of the three putative CPEs [B1(-CPE)] were generated and processed. As shown in Fig. 3, progesterone-induced polyadenylation of the B1 probe but not of the B1(-CPE) probe.

The methods described in Subheading 3.2.1. outline the generation of a DNA template for in vitro transcription by PCR; Subheading 3.2.2. describes the preparation of radiolabeled RNA probe by in vitro transcription; Subheading 3.2.3. discusses RNA extraction from X. laevis oocytes; and Subheading 3.2.4. addresses visualization of poly(A) addition by RNA electrophoresis in polyacrylamide-urea gel and autoradiography.

The oocytes are injected as described in Subheading 3.1.3., with the single difference that more RNA can now be injected because polyadenylation has a higher toler ance to saturation than translational repression. Typically 4.6 fmol, equivalent to 14,000 cpm (Cerenkov), are injected.

3.2.1. Generation of DNA Template for In Vitro Transcription by PCR

The DNA template for in vitro transcription is generated by PCR, from the luc-3'UTR plasmid described in Subheading 3.1.1., with a sense oligonucleotide that contains a phage promoter sequence (T3, T7, or Sp6) at its 5' end, thus generating a PCR product that can be used directly as a DNA template for in vitro transcription, and an antisense oligonucleotide complementary to the 3'-UTR under study. Following PCR, the DNA is purified by phenol/chloroform/isoamyl alcohol extraction and isopropanol precipitation (33).

For the study of cyclin B1 3'-UTR polyadenylation, the DNA templates were generated from the cyclin B1 3'-UTR and the cyclin B1(-CPE) 3'-UTR plasmids (see Subheading 3.1.1.) with the sense T3Luc-s oligonucleotide and the antisense B1-as or B1(-CPE)-as oligonucleotide, as described in Subheading 2.7.

3.2.2. Preparation of Radiolabeled RNA Probe by In Vitro Transcription

1. Set up a 10-|lL reaction containing the following components added sequentially as indicated:

a. 100 ng Linearized DNA template.

b. 2 ||L 5X Transcription buffer.

h. DEPC-treated water (10 | L final volume of the reaction).

3. Once the transcription is complete, degrade the DNA template by adding 1 |L of RNase-free DNase (2 U/|L) and incubating at 37°C for 15 min.

4. Purify the RNA probe from the unincorporated nucleotides, either by phenol/chloroform/ isoamyl alcohol extraction and isopropanol precipitation or by filtration through Sephadex G-25 minicolumns (RNase free). The preparation and running of such columns is thoroughly described in ref. 33; however, the column should be equilibrated in water rather than in TE. Typically, the yield after purification is 200 to 300 ng of RNA with a specific activity of approx 10,000 cpm/ng.

5. Verify the quality of the RNA in a denaturing gel. Assemble a 6% polyacrylamide/8M urea minigel 7 cm long. Prerun it in 1X TBE buffer at 28 V/cm for 15 min. Mix the RNA (1 |L) with gel-loading buffer and heat it at 70°C for 10 min. Load the samples and run the gel for 20 min (see Note 15). Determine the position of the transcript by brief autoradiography (5-10 min) without drying the gel. Excise the band and quantify the cpm (Cerenkov) (see Note 6).

3.2.3. RNA Extraction From Xenopus laevis Oocytes

1. Homogenize five oocytes (or fewer) by adding 500 |L of PAS buffer; vortex and pipet the sample up and down through a 200-|L tip. Add 500 |L of phenol/chloroform/isoamyl alcohol and vortex thoroughly.

2. Centrifuge at 16,000g for 15 min at 4°C. Remove the aqueous (upper) phase to a clean tube, avoiding precipitated material from the interface. Add 1 volume of phenol/chloro-form/isoamyl alcohol and repeat the extraction.

3. Again, remove the aqueous phase to a clean tube. Add 1/10 volume of 3 M ammonium acetate, pH 5.2, and 2.5 volume of 100% ethanol. Mix by inversion. Keep at -20°C for 30 min.

4. Recover the RNA by centrifugation at 16,000g for 30 min at 4°C. Discard the supernatant and wash the pellet with 70% ethanol, air dry, and resuspend in 10 ||L DEPC-treated water (see Note 4).

5. Denature the total RNA sample by adding gel-loading buffer and heating at 70°C for 10 min.

3.2.4. Visualization of Poly(A) Addition by RNA Electrophoresis in Polyacrylamide-Urea Gel and Autoradiography

Total RNA extracted from oocytes is resolved by polyacrylamide-urea gel electrophoresis, and the labeled probe is detected by autoradiography. Because the expected size differences between the polyadenylated and nonpolyadenylated labeled RNAs range between 80 and 150 nucleotides, the resolution of the gel has to be adjusted according to the size of the injected RNA. For cyclin B1 3'-UTR, a 6% polyacryla-mide/8 M urea gel 28 cm long was used, with a running time of 2 h. For RNAs 300 nucleotides long, a lower percentage of polyacrylamide (4-5%) and longer running times (up to 5 h) may be required.

1. Assemble a 1-mm thick polyacrylamide-urea gel making sure that one of the glass plates is silanized.

2. Prepare the gel with 6% polyacrylamide/8 M urea gel solution.

3. Prerun the gel in 1X TBE at 14 V/cm for 45 to 60 min at room temperature.

4. Load the denatured sample corresponding to two oocytes per well.

5. Run the gel at 14 V/cm for 2 h at room temperature.

6. Remove one of the glass plates and transfer the gel to a double layer of Whatman 3MM filter paper by overlaying and gently peeling it off. Note that these low-percentage gels are not easy to handle as they tend to be loose and sticky.

7. Dry the gel and expose to X-ray film in a cassette with an amplifying screen for 16 h at -80°C and develop the autoradiograph according to the manufacturer's instructions.

0 0

Post a comment