Info

Source Data from the Wiley Journal of Gene Medicine Clinical Trial Database at the Abbreviations GC, glucocerebrosidase OTC, ornithine transcarbamylase ADA, adenosine deaminase SCID, severe combined immunodeficiency CTFR, cystic fibrosis transmembrane conductance regulator AAV adeno-associated virus p47, phox gene for antimicrobial oxidant. LDLR, low-density lipoprotein receptor IRAP, interleukin 1 receptor antagonist VEGF, vascular epithelial growth factor. aGene therapy trials for cancer are...

Effects of Infectious Disease on Human History

America's Forgotten Pandemic The Influenza of 1918. Cambridge University Press, Cambridge, England. Gould, T. (1995). A Summer Plague Polio and its Survivors. Yale University Press, New Haven, CT. Hopkins, D. R. (1983). Princes and Peasants Smallpox in History. University of Chicago Press, Chicago. Kolata, G. (1999). Flu The Story of the Great Influenza Pandemic of 1918 and the Search for the Virus that Caused It. Farrar, Straus, & Giroux, New York. Koprowski, H., and...

Aav

Difficult to purify, difficult to scale up response, toxicity response, toxicity Insertional Diminishing as unvaccinated population grows Disseminated vaccinia in immunocompromised hosts Source Verma and Somia (1997) and Jolly (1994). TABLE 9.3 Gene Therapy in Clinical Trials in the United States as of 2000 of Number of Results Gaucher's disease GC Retrovirus 3 OTC deficiency OTC Adenovirus 1 ADA-SCID ADA + NeoR Retrovirus 1 Cystic fibrosis CFTR Adenovirus 9 Chronic p47 phox Retrovirus 3...

Virion

FIGURE 5.2 Diagram showing the overall organization of the genes in the retroviral RNA genome, the comparable organization of the DNA provirus, and the location of the various virus-encoded proteins in the mature virion. The RNA strand is shown in green the DNA provirus is shown in blue. The open reading frames (ORFs) in the genome are color coded to match their products in the virion. The nontrans-lated regions of the RNA genome and the long terminal repeats (LTRs) are described in detail in...

I8g39

Vindeln L ranica i cg1820 sotkamo 90-13 -Tula - Black Creek Canal Laguna Negra (Old world rats and mice, found in Europe and Asia) (Voles found in Europe, Asia, and the Americas) (New World rats and mice, found only in the Americas) FIGURE 4.21 Phylogenetic tree of rodent-borne hantaviruses derived from the nucleotide sequence of the M RNA segment. This tree illustrates that hantaviruses have coevolved with their rodent hosts for millions of years. However, note (*) that in contrast to other...

Neutralization of Charge on the Virion Genome

DNA or RNA has a high net negative charge, and there is a need for counterions to neutralize this charge in order to form a virion. In many viruses, positively charged polymers are incorporated that neutralize half or so of the nucleic acid charge. The DNA in the virions of the polyomaviruses is complexed with cellular histones. The viral genomes in these viruses have been referred to as minichromosomes. In contrast, the adenoviruses encode their own basic proteins that complex with the genome...

Family Rhabdoviridae

The genome organization of the rhabdoviruses is the simplest of the (-)RNA viruses and it is useful to begin our coverage with this group, The genome is a single piece of minus-strand RNA 11-15 kb in size. In most viruses, the genome has five genes, which result in the production of six or seven proteins, five of which are present in the virion. The animal rhabdoviruses are bullet shaped, approximately 200 nm long and 75 nm in diameter (Fig. 2.19), whereas some of the plant viruses are...

Hdv 286287

Bunyaviruses, 157, 158 influenza viruses, 149-150 minus-stranded RNA viruses, 126 orthoreoviruses, 112 VSV 128-129 T antigen regulation, 261, 263-264 pregenomic, 22 replication alphavirus, 79 influenza viruses, 149-150 NS proteins, 88-89 picornavirus, 62 reverse transcription, 175 splicing, discovery, 254 subgenomic, production, 102 transcription in hepadnavirus, 212 in papillomaviruses, 266 in simple retroviruses, 177-178, 180 transactivation, 186-187 translation, interference, 332 unspliced,...

No Viral Replication

C ) Ribosome www ds RNA Phosphate group Phosphorylated EIF2 Activated RNase L FIGURE 8.18 The antiviral state, (A) Development of the antiviral state begins with the action of interferon on an uninfected cell, The result of the signal transduction cascade shown in Fig, 8,17 is the induction of expression of up to 100 genes, of which three are shown RNase L, the 2'-5' oligo(A) synthetase (2'-5' OS), and the dsRNA-dependent protein kinase (PKR), These proteins are latent until they are activated...

Family Papillomaviridae

Papillomaviruses resemble polyomaviruses in structure but are larger (Fig. 2.5). The virion is 55 nm in diameter, and the circular dsDNA genome is 8 kb in size. Replication and assembly of progeny virus occur in the nucleus. A partial listing of papillomaviruses is shown in Table 6.13. They are primarily mammalian viruses, but there are a few avian representatives in the family. The viruses are species specific. They infect epithelium and will undergo a complete replication cycle only in...

Other Structural Proteins in Enveloped Viruses

In some enveloped viruses, there is a structural protein that underlies the lipid envelope but which does not form part of the nucleocapsid. Several families of minus-strand RNA viruses possess such a protein, called the matrix protein. This protein may serve as an adapter between the nucleocapsid and the envelope. It may also have regulatory functions in viral RNA replication. The her-pesviruses also have a protein underlying the envelope that is called the tegument protein. This protein forms...

H2

FIGURE 7.10 Mutations found in the human prion protein gene. Polymorphisms that are phenotypically wild type are shown below the schematic of the gene mutations that segregate with inherited prion diseases are shown above the gene. GSS, FFI, and CJD are defined in Table 7.2. Adapted from Prusiner (1998) and Riek et al. (1996). animals that share pasturage with infected sheep, such as white-tailed deer, mule deer, and elk (where the disease is called chronic wasting disease), In these cases, it...

Chapter

A., McPherson, S., and Morrow, C. D. (2000). Cytokine production in motor neurons by poliovirus replicon vector gene delivery. Nat. Biotechnol. 18 964-969. Chambers, T. J., Nestorowicz, A., Mason, P. W., and Rice, C. M. (1999). Yellow-fever Japanese encephalitis chimeric viruses Construction and biological properties. J. Virol. 73 3095-3101. Conzelmann, K.-K., and Meyers, G. (1996). Genetic engineering of animal RNA viruses. Trends Microbiol. 4 386-393. Crystal, R....

Eukaryotic Host Cell

FIGURE 1.11 Replication of a retrovirus. After entering the cell, the retrovirus RNA genome is reverse transcribed into double-stranded DNA by RT present in the virion. The DNA copy migrates to the cell nucleus and integrates into the host genome as the provirus. Viral mRNAs are transcribed from proviral DNA by host cell enzymes in the nucleus. Both spliced and unspliced mRNAs are translated into viral proteins in the cytoplasm. The capsid precursor protein, Gag, and RT are translated from...

Khh

E1A proteins, 255-256 EAV. see Equine arteritis virus epidemic, 145-146 genome organization, 144 isolation, 145 E1B proteins, 255-256 EBV see Epstein-Barr virus Echoviruses, 67 E2F proteins, 255-256 E5 gene, 266, 268 E6 gene, 266, 268 E7 gene, 266, 268 EIAV. see Equine infectious anemia virus Elongation factors, 23 EMC. see Encephalomyocarditis virus Encephalitic alphaviruses, 80-82 Encephalitis, associated viruses, 93-96 Encephalomyocarditis virus, 68 Encephalopathies, transmissible...

Enveloped Viruses

The nucleocapsids of most enveloped viruses form within the cell by pathways assumed to be similar to those described above. They can often be isolated from infected cells, and for many viruses the assembly of nucleocapsids does not require viral budding or even the expression of viral surface glycoproteins. After assembly, the nucleocap-sids bud through a cellular membrane, which contains viral glycoproteins, to acquire their envelope. Budding retroviruses were illustrated in Fig. 2.17 and...

J

FIGURE 1.8 Replication of an enveloped, plus-strand RNA virus. After the virus attaches to a cellular receptor, fusion of the virus envelope with the cell plasma membrane or with an endocytic vesicle releases the nucleocapsid into the cytoplasm. The genome RNA is an mRNA, and is translated on cytoplasmic ribosomes into the proteins required for RNA synthesis. The synthetase complex can both replicate the RNA to produce new genomes and synthesize viral subgenomic mRNAs from a minus-strand copy...

Further Reading

Defective interfering viruses. In Encyclopedia of Virology (A. Granoff and R. G. Webster, eds.), Vol. 1, pp. 371-375. Academic Press, San Diego, California. Flores, R., Di Serio, F., and Hern ndez, C. (1997). Viroids The noncoding genomes. Semin. Virol. 8 65-73. Pelchat, M., L vesque, D., Ouellet, J., et al. (2000). Sequencing of peach latent mosaic viroid variants from nine North American peach cultivars shows that this RNA folds into a complex secondary structure. Virology...

Cd

Moloney murine sarcoma virus (defective) FIGURE 5.13 Representative v-onc-containing retroviral genomes and the nondefective retroviruses from which they were derived by capture of cellular oncogenes. In each case the inserted oncogene is shown as a patterned domain in the DNA and its product as a green box. For Rous sarcoma virus, the src gene is expressed from a new spliced message. For Abelson murine leukemia virus, the bl gene is present in a fusion protein with a deleted form of gg. Myb...

If

Inverted terminal repeats form hairpins Elongation from 3'OH Nick at green arrowhead _d A c b a Elongation from nick to left Reform hairpins for primers Lagging strand with multiple primers Leading strand with RNA primer Replication complex O Preterminal protein O DPB - single strand DNA binding protein FIGURE 1.7 Models for DNA replication in various virus groups. Because DNA chains cannot be initiated de novo, viruses have used a variety of ways to prime new synthesis, such as (A) using RNA...

Lnw

FIGURE 9.5 Generation of poliovirus replicons for expression of foreign genes in motor neurons. Based on an earlier construct to express interleukin-2 via a poliovirus replicon, the gene for wild-type murine (TNF-a) was positioned between the VP0 and 2A proteins of poliovirus, replacing VP3 and VP1. It was flanked on either side by sites for cleavage by the poliovirus 2A protease. These constructs were injected into transgenic mice expressing the poliovirus receptor, and expression of murine...

Family Caliciviridae

The caliciviruses are nonenveloped viruses with icosahe-dral symmetry and a diameter of about 30 nm. The name comes from the Latin word for cup or goblet because there are cup-like depressions in the surface of the virion when viewed in the electron microscope. The characteristics of a number of caliciviruses are shown in Table 3.5. Caliciviruses are currently classified into four genera, two of which, the Norwalk-like viruses and the Sapporo-like viruses, contain agents that cause human...

Family Arenaviridae

A listing of representative arenaviruses is found in Table 4.10. The arenaviruses share many features with the hantaviruses. They are associated with rodents and have coe-volved with them, as have the hantaviruses. They are transmitted to humans by contact with aerosolized rodent urine or feces many cause very serious illness, often hemorrhagic fever, with a high mortality rate. Their genome organization has much in common with the hantaviruses, as described below. Arenaviruses are typical...

Ns

A component of the virion), as well as a few molecules of an RNA-dependent RNA polymerase. The polymerase is a large, multifunctional protein called L in most families but is present as three proteins in the Orthomyxoviridae. L and P form a core polymerase that replicates the viral genome and synthesizes mRNAs. A matrix protein (M) is present in all of the viruses except the bunyaviruses and the arenaviruses. M underlies the lipid bilayer where it interacts with the nucleocapsid. M also...

L

Hepatitis virus, a murine coronavirus, are illustrated in Fig. 7.2B. Because DI RNAs are replicated by the helper virus machinery and encapsidated by the capsid proteins of the helper virus, they interfere with the parental virus by diverting these resources to the production of DI particles rather than to the production of infectious virus particles. It was first noted by von Magnus in the early 1950s that influenza virus passed at high multiplicity for many passages produced yields that...

T

FIGURE 6.31 Stable hairpin structures predicted from the palindromic sequences at the 3' termini of parvo-virus virion DNAs. (A) Diagram of the genome, showing the location of the hairpin. (B) The most stable secondary structure predicted by the 3' terminal nucleotide sequences of MVM DNA and AAV DNA minute virus of mice (MVM) is now called mice minute virus (MMV) as shown in Table 6.15. Adapted from Fields et l. (1996, p. 2175). B19 is a common virus. About 50 of adults have antibodies against...

F

FIGURE 7.1 Schematic representation of DI RNAs found after high multiplicity infection by Semliki Forest virus. The central block shows the genome of the nondefective virus, with vertical lines denoting the four nonstructural and five structural polypeptides. The blocks of sequence found in two different DIs are expanded fourfold below and above. Their location in the DI genome is illustrated with blocks of identical shading. Note that some blocks of unique sequence are repeated three times in...

Viruses Cause Disease But Are Also Useful as Tools

Viruses are of intense interest because many cause serious illness in humans or domestic animals, and others damage crop plants. During the last century, progress in the control of infectious diseases through improved sanitation, safer water supplies, the development of antibiotics and vaccines, and better medical care have dramatically reduced the threat to human health from these agents, especially in developed countries. This is illustrated in Fig. 1.1, in which the death rate from...

Aids

Neurological disease Northern Europe Representative replication competent members are shown the first listed is the type species of the genus. Alpharetroviruses were formerly avian type C, betaretroviruses include the mammalian type B and the type D retroviruses gammaretroviruses were mammalian type C, deltaretroviruses were BLV HTLV and epsilonretrovirus is a new genus of piscine viruses. bPrimate T-lymphotropic virus 1 (PTLV-1) was formerly known as human T-cell leukemia virus and referred to...

Iii

FIGURE 3.10 Phylogenetic tree of HEV isolates based on the complete sequences of ORF2 (1983nt), encoding the coat protein. Isolates are listed by year and location of isolation. Branch lengths are proportional to the evolutionary distance between sequences. Roman numerals are used to denote genotypes (< 85 nucleotide sequence identity), and Arabic numbers denote subgenotypes (< 92.5 nucleotide sequence identity). The genetic groupings of the HEV strains reflect the geographic relationships...

Mid Bf

FIGURE 3.13 Phylogenetic trees of the alphaviruses, constructed using maximum parsimony and bootstrap analysis. The Old World viruses are shown in blue, the New World viruses in orange. The vertical distances are arbitrary, but the lengths of the horizontal branches indicate the number of amino acid substitutions along the branch and some bootstrap values are indicated at the nodes. (A) A tree derived from the amino acid sequences of nonstructural proteins nsP2 and the conserved domain of nsP3,...

B

FIGURE 8.2 (A) Schematic representation of MHC class I and MHC class II molecules. The orientation of these molecules at the cell surface is indicated, as are the domain structure of the extracellular portions of the proteins, the membrane-spanning domains, and the cytoplasmic domains, and how they function in the cell. The blue and green spheres represent bound peptide antigens. (B) Three-dimensional ribbon diagram of the structure of MHC-1 (HLA-A2), as determined by X-ray crystallography....

Translation and Processing of Viral Proteins

Viral mRNAs are translated by the cellular translation machinery. Most mRNAs of animal viruses are capped and polyadenylated. Thus, the translation pathways are the same as those that operate with cellular mRNAs, although many viruses interfere with the translation of host mRNAs to give the viral mRNAs free access to the translation machinery. However, there are mechanisms of translation and processing used by some viruses that have no known cellular counterpart. These appear to have evolved...

Family Parvoviridae

The Parvoviruses are small icosahedral viruses that are 18-26 nm in diameter (Figs. 2.1 and 2.5). They contain ssDNA of about 5 kb as their genome. Different viruses variously package the minus strand (the strand complementary to the messenger sense) or a mixture of plus and minus strands. Two subfamilies are recognized, each containing three genera. The Parvovirinae are viruses of birds and mammals, whereas the Densovirinae are viruses of insects. A partial listing of the members of the...

Family Polyomaviridae

Until recently, the polyomaviruses and the papillo-maviruses were considered to be two subfamilies within the family Papovaviridae. The name papova came from papilloma virus polyoma virus simian vacuolating virus ( SV40), three characteristic members of the enlarged family. Recently, the ICTV has elevated the two subfamilies to the status of full families, and that is the treatment followed here. A partial listing of the members of the family Polyomaviridae is given in Table 6.11....

Orfq

The genetic organizations of these elements are compared in Fig. 5.24. Endogenous retroviruses are proviruses that have become established in the germ line of many different organisms at various times in the past. They align with the retroviruses in the tree in Fig. 5.23, and their genetic orga nization is identical to that of the simple retroviruses (see Fig. 5.24). However, many are defective, having deletions or mutations in them that prevent them from undergoing a full...

Introduction

Virus particles, called virions, contain the viral genome encapsidated in a protein coat. The function of the coat is to protect the genome of the virus in the extracellular environment as well as to bind to a new host cell and introduce the genome into it. Viral genomes are small and limited in their coding capacity, which requires that three-dimensional virions be formed using a limited number of different proteins. For the smallest viruses, only one protein may be used to construct the...

Pxs

Gag, Pro, Pol, Env, and other proteins REV response element (RRE) C0 Rev oligomer ----- Components of spliceosome RAB (similar to nucleoporins) FIGURE 5.12 Model of Rev action. Rev is thought to (A) mediate export of nonspliced or singly spliced RRE-containing RNAs from the nucleus (B) inhibit complete splicing of mRNA (c) enhance translation of unspliced and singly spliced mRNAs. Adapted from Collins et al. (1997, p. 244). exported to the cytoplasm can also be packaged into progeny virions. In...

Atomic Structure of Bluetongue Virus

Members of the reovirus family are regular T 13 icosa-hedral particles. They are composed of two or three concentric protein shells. Cryoelectron microscopy has been used to solve the structure of one or more members of three genera within the Reoviridae, namely, Reovirus, Rotavirus, and Orbivirus, to about 25-A resolution. Structures of a reovirus and of a rotavirus are shown in Fig. 2.5. The complete structure of virions has not been determined because of their large size, but in a remarkable...

Vaccinia Virus

The poxviruses, large DNA-containing viruses, also have lipid envelopes. In fact, they may have two lipid-con-taining envelopes. The structures of poxviruses belonging to two different genera, Orthopox and Parapox, are illustrated in Fig. 2.20. Electron micrographs of the orthopox virus vaccinia virus and of a parapox virus are also shown. Vaccinia virus has been described as brick shaped. The interior of the virion consists of a nucleoprotein core and two proteinaceous lateral bodies....

Ptlv2

FIGURE 5.1 Phylogenetic tree of the Retroviridae drawn from the amino acid sequences of the reverse transcriptases. The lengths of the branches are proportional to the degree of divergence the names of the simple retrovirus genera are boxed in black, the complex genera are boxed in red. The green ovals indicate the acquisition of new genes during the evolution of current extant viruses. Most of the virus name abbreviations are found in Table 5.1 HERV-C and HERV-K are defective retroviruses in...

Jzd

0 Pro protease Q RT reverse transcriptase FIGURE 5.6 Organization of the gag, pro, and pol genes of representative retroviruses belonging to each genus. In some cases two frameshifts are required to generate a complete Gag-Pro-Pol precursor. The gag proteins are illustrated in more detail in Fig. 5.7. This figure is a composite of Goff (1997, Fig. 3.16, p. 157) and Coffin et al. (1997, pp. 45, 269, 795, 799).

1

Infectious VSV With CD4,CXCR4 (mutant VSV) FIGURE 9.7 Producing a mutual VSV targeted to kill HIV-infected cells. (A) Genome of a rhabdovirus in which the glycoprotein G gene has been replaced with sequences encoding CD4 and CXCR4, the HIV primary receptor and coreceptor, and a schematic of a cDNA clone containing the genome sequence (cDNA copy of vRNA). (B) A susceptible cell is infected with vaccinia virus expressing the T7 RNA polymerase, and four separate plasmids the mutant genome plasmid...

The Many Kinds of Viruses

Three broad classes of viruses can be recognized, which may have independent evolutionary origins. One class, which includes the poxviruses and herpesviruses among many others, contains DNA as the genome, whether single stranded or double stranded, and the DNA genome is replicated by direct DNA DNA copying. During infection, the viral DNA is transcribed by cellular and or viral RNA polymerases, depending on the virus, to produce mRNAs for translation into viral proteins. The DNA genome is...

The Plusstrand Rna Viruses Of Plants

Most plant viruses possess (+)RNA as their genome. Some have as their genome a single RNA molecule and produce subgenomic mRNAs, whereas in others the viral genome is divided into two or three or more segments. In plant viruses in which the genome is present in more than one segment, each segment is packaged separately into different particles and infection requires the introduction into the same cell of at least one of each genome segment. Many (+)RNA plant viruses are rod shaped, formed using...

Megamyxovirus Nipah

I ORF3 * **** * Cysteine-rich domain FIGURE 4.7 Translation strategy of the P gene of paramyxoviruses. In most paramyxoviruses, nontemplated nucleotides are inserted during synthesis of the PmRNA to shift the translation frame. Alternative translation start codons are also used. The result is the production of up to four proteins from this one gene. Adapted from Strauss and Strauss (1991, Fig. 1) and Chua et al. (2000).

Aku

Antibody secretion, 311-312, 315-317 EBV and, 246-248 memory, 317 Bcl-2, 325-326, 339-340 BDV see Border disease virus Beta genes, 240-243 Betaherpesviruses, 238 Betaretroviruses. see also specific viruses characterization, 194 dUTPase gene, 189 Beta-sandwich fold, 36-37 BK virus characterization, 264 infections, 264-265 Blood-borne transmission, 29-30 Blue tongue virus atomic structure, 40-42 characterization, 118 symmetry, 36-37 BMV see Brome mosaic virus Border disease virus, 98-99 Borna...

Vld

J Cap-snatching, mRNA synthesis, t splicing 3 FIGURE 4.14 Synthesis of two mRNAs for the M1 and M2 proteins from gene segment 7 of influenza A. M1 RNA is translated from ORF1 (open box). M2 RNA starts identically, but after the splice it is translated in ORF2 (checked box). Both proteins are found in infected cells. The AUG initiation codon is shown as a triangle termination codons are shown as filled diamonds. Patterned boxes at the end of the genome RNA are self-complementary sequences not...

Academic Press

San Diego San Francisco New York Boston London Sydney Tokyo Cover illustration The binding of a neutralizing antibody to the surface of a human rhinovirus. Cryoelectron microscopy was used to determine the structure of human rhinovirus 14 with bound monoclonal antibody to about 25 resolution Smith, T. J., Olson, N. H., Chen, R. H., Chase, E. S., and Baker, T. S. ( 1993). Structure of a human rhinovirus-bivalent antibody complex Implications for virus neutralization...

Effects Of Virus Infection On The Host Cell

Cells can be described as permissive, semipermissive, or nonpermissive for virus replication, Semipermissive or non-permissive cells lack factors required for a complete replication cycle, The term nonpermissive usually refers to a cell in which no progeny virus are produced, A cell may be nonper-missive because it lacks receptors for the virus or because it lacks factors required by the virus after entry, In the latter case, an abortive infection may occur in which virus replication begins but...

Family Togaviridae

The family Togaviridae contains two genera, genus Alphavirus and genus Rubivirus. The family name comes from the Latin word for cloak, and the name was given to them because they are enveloped. The 26 alphaviruses have a (+)RNA genome of about 12 kb, whereas rubella virus, the only member of the Rubivirus genus, has a genome of 10 kb. The genomes of alphaviruses and of rubella virus are organized in a similar fashion, as illustrated in Fig. 3.12. The virions of the two groups are also roughly...

P

Burkitt's lymphoma, 249 cell cycle regulation by, 268 concentrations control of, 340-341 T antigen binding to, 260 p80, 98 P123, 76, 77 p125, 98 Papain-like proteases, 27 Papillomaviruses. see also specific viruses characterization, 259, 265 classification, 259 DNA replication, 261 early genes, 259-260 human, 264-265 infection, 265 mRNA transcription, 266 target proteins, 256 transforming genes, 266, 268 Parainfluenza viruses, 135-137 Paramyxoviruses. see also specific viruses emerging, 142-143...

Kfd

Africa Africa, Middle East, Balkans, Russia, W. China Infected field rodents, Calomys musculinus Infected field rodents, Calomys callosus Each virus maintained in a single species of infected rodents As for viruses causing HFRS Poorly understood cycle involves ticks, voles, muskrats

Vp0

RNAs that require the cap-binding protein complex, that is, capped cellular mRNAs. The cardioviruses, which are also cap-independent, interfere with translation of host mRNAs in a different way, by interfering with phosphorylation of cap-binding protein. Poliovirus may also interfere with other initiation factors in addition to the cap-binding protein in order to achieve the profound inhibition of host protein synthesis that is observed. The viral 3Cpro and its precursor 3CDpro make multiple...

Transformation

FIGURE 6.25 Interactions of polyoma middle T antigen with membrane proteins to initiate cellular transformation. Phosphatidylinositol-3 kinase (PI3K) and c-src are localized in the plasma membrane. The src kinase phosphorylates middle T on a tyrosine residue (Y). This generates binding sites for a variety of other cellular signaling proteins such as PI3K. The resultant complex closely resembles an activated growth factor receptor bound to signal transduction proteins. Serine residues (S) on...

Viral Counterdefenses

Mammals have evolved elaborate defenses to ward off infection by viruses. Viruses, in turn, have evolved coun-terdefenses that allow them to persist and continue to infect mammals. These counterdefenses vary from the simple to the elaborate. The simplest counterdefense is to shut down A) Development of the antiviral state B) Virus attempts to replicate in a cell in the antiviral state

Hiv2

FIGURE 5.10 Structures of HIV-1 and HIV-2 TAR RNA elements. Nucleotides are numbered from the 5' end of the RNA. For HIV-1, positions involved in binding to TAT protein (yellow oval) are circled, and the bases involved in tertiary structure alterations following Tat binding are shown in red. Less is known about the HIV-2 Tat blinding. Adapted from Coffin et al. (1997, Fig. 12, p. 226). complex is more processive, allowing the production of complete RNA genomes rather than truncated transcripts....

Pjd

FIGURE 4.13 Relationship between genome RNAs, mRNAs, and vcRNAs of influenza virus. Synthesis of mRNAs in the cell nucleus requires a primer of 10-13 nucleotides derived from cellular pre-mRNAs by cap-snatching, and mRNAs terminate with a poly(A) tail. Those portions of the mRNA that are not complementary to the genome RNA are shown in red. In contrast, vcRNAs are exact complements of the genomic minus strands. Adapted from Strauss and Strauss (1997). (Fig. 4.13), which is a perfect complement...

Family Filoviridae

Table 4.5 lists the known filoviruses, which are classified into two genera, the Marburg-like viruses and the Ebola-like viruses. The filovirus genome is 19 kb in size and contains seven genes, which result in the production of seven or eight proteins following infection (Fig. 4.1). The molecular biology of filoviruses is not well understood, in part because most known filoviruses are severe human pathogens that must be handled under biosafety level 4 conditions. The genomes of Ebola virus and...

Q

FIGURE 8.11 Time course of development of circulating antibodies after primary and secondary immunizations, No timescale has been shown, since the actual results vary depending upon the antigen, adjuvant, site of injection or infection, and animal species, From Kuby (1997, Fig, 16,19, p, 398), 5' VDJ C C5 C- 3 Gyl C- 2b Cy2a C Ca 3' Sy3 Sy1 Sy2b Sy2a Se Sa Recombination between S and Sy1 Transcription, splicing, polyadenylation Transcription, splicing, polyacenylation FIGURE 8.12 Immunoglobulin...

Structure of Adenoviruses

Cryoelectron microscopy has also been applied to adenoviruses, which have a triangulation number of 25 or pseudo-25. Various interpretations of the structure of adenoviruses, both schematic and as determined by microscopy or crystallography, are shown in Fig. 2.12. Three copies of a protein called the hexon protein, whose structure has been solved to atomic resolution, associate to form a structure called a hexon (Fig. 2.12C). The hexon is the basic building block of adenoviruses. Five hexons,...

Auagggauacuuuuuuugauugucucuag

Genomic sequences at other intergenic regions in the VSV genome N P CGAUGUAUACUUUUUUUGAUUGUCUAUAG P M CAUCUGAUACUUUUUUUCAUUGUCUAUAG G L UUAAAAAUACUUUUUUUGAUUGUCGUUAG FIGURE 4.2 (A) Schematic diagram of the VSV genome, where le is the leader sequence and tr is the trailer sequence. The five genes N, P, M, G, and L were defined in the legend to Fig. 4.1 and are described in more detail in the text. The positions of the conserved regulatory sequences at the gene boundaries are shown by the...

Innate Immune System

The innate immune system is composed of a large number of elements that attempt to control infection by pathogens, but this system is independent of the identity of the particular pathogen. Complement is a component of the innate system as well as the adaptive system and has been described. Other components of the innate system include the cytokines, a complicated set of small proteins that are powerful regulators of the immune system. Many cytokines are critical for the function of the...

The Nature of Viruses

Viruses are subcellular, infectious agents that are obligate intracellular parasites. They infect and take over a host cell in order to replicate. The mature, extracellular virus particle is called a virion. The virion contains a genome that may be DNA or RNA wrapped in a protein coat called a capsid or nucleocapsid. Some viruses have a lipid envelope surrounding the nucleocapsid (they are enveloped). In such viruses, glycoproteins encoded by the virus are embedded in the lipid envelope. The...

Transformation of Cells

The normal outcome of the infection of a cell by a virus is the death of the cell and the release of progeny virus. The major exceptions are the persistent infection of cells by retroviruses and the latent infection of cells by viruses such as herpesviruses, in which the cell survives with its properties little altered except for the new ability to produce virus. However, another possible outcome is the transformation of the cell, which involves not only the survival of the cell but an...

Structure of Other Enveloped Viruses with Icosahedral Nucleocapsids

The flaviviruses, like the alphaviruses, appear to be regular icosahedral stuctures (Fig. 2.5). The arteriviruses FIGURE 2.14 Structure of Ross River virus reconstructed from cryo-electron microscopy. (A) Cutaway view of the cryoelectron microscopic reconstruction illustrating the multilayered structure of the virion. Envelope glycoproteins are shown in blue, the lipid bilayer in green, the ordered part of the nucleocapsid (Fig. 2.15) in yellow, and the remainder of the nucleocapsid in orange....

Family Coronaviridae

The name coronavirus comes from the Latin word meaning crown, from the appearance of the array of spikes around the enveloped virion. The family is composed of a number of RNA-containing animal viruses currently classified into two genera, the genus Coronavirus (whose members will here be called coronaviruses) and the genus Torovirus (whose members will be referred to as toroviruses). A representative listing of viruses in the two genera is found in Table 3.11. The family has recently been...

Stability Of Virions

Virions differ greatly in stability, and these differences are often correlated with the means by which viruses infect new hosts. Viruses that must persist in the extracellular environment for considerable periods, for example, must be more stable than viruses that pass quickly from one host to the next. As an example of such requirements, consider the closely related polioviruses and rhinoviruses, members of two different genera of the family Picornaviridae. These viruses shared a common...

Icosahedral Symmetry

Virions can be approximately spherical in shape, based on icosahedral symmetry. Since the time of Euclid, there have been known to exist only five regular solids in which each face of the solid is a regular polygon the tetrahedron, the cube, the octahedron, the dodecahedron, and the icosa-hedron. The icosahedron has 20 faces, each of which is a regular triangle, and each face thus has threefold rotational symmetry (Fig. 2.3A). There are 12 vertices where 5 faces meet, and thus each vertex has...

Epidemiology The Spread Of Viruses From Person To Person

Viruses must be able to pass from one infected organism to another. The spread of specific viruses will be consid ered together with their other attributes in the chapters that follow, but it is useful to consider virus epidemiology in overview at this point. The tissues infected by a virus and the seriousness of the disease caused by it are attributes that determine in part the mechanism of spread of a virus. Thus, knowledge of the epidemiology of a virus is important for understanding the...

O

(CH) N-linked carbohydrate chains H Helical regions of PrPc X GPI (glycosyl phosphatidylinositol) 0 P-sheets in PrPc FIGURE 7.15 Isoforms of the human prion protein. The precursor protein is 254 amino acids long. Maturation involves removal of the N-terminal signal sequence and the C-terminal 23 amino acids (two boxes marked S), attachment of the new C terminus to a GPI anchor, and N-linked glycosylation at Asn181 and Asn197. After exposure to scrapie prions, the protein is converted to PrPSc,...

Atomic Structure of Viruses Having Pseudo73 Symmetry

The structures of several picornaviruses and of a plant comovirus (cowpea mosaic virus) have also been solved to atomic resolution. The structures of these viruses are similar to those of the plant T 3 viruses, but the 180 subunits that form the virion are not all identical. A comparison of the structure of a T 3 virus with those of poliovirus and of cowpea mosaic virus is shown in Fig. 2.7. Poliovirus has 60 copies of each of three different proteins, whereas the comovirus has 60 copies of an...

Cfv Hsrv

Avian myeloblastosis (AMV) Avian myelocytomatosis (AMCV-29) Moloney sarcoma (MoMSV) Harvey murine sarcoma (HaMSV) Gardner-Arnstein Vertical including mothers' milk sexual transmission, blood Neonatal infection, sexual transmission, blood Mammary carcinoma, Worldwide T-cell lymphoma B-cell lymphoma T-cell lymphoma, neurological disorders TSP, HAMC

Penetration

Cell Membrane Penetration

After the virus binds to a receptor, the next step toward successful infection is the introduction of the viral genome into the cytoplasm of the cell, In some cases, a subviral particle containing the viral nucleic acid is introduced into the cell, This particle may be the nucleocapsid of the virus or it may be an activated core particle, For other viruses, only the nucleic acid is introduced, The protein(s) that promotes entry may be the same as the protein(s) that binds to the receptor, or it...

Lytic Infection or Latent Infection

In a lytic infection, the virus replicates to high titer, host cell macromolecular synthesis is shut down, and the host cell dies. Bacterial cells are usually actively lysed by the elaboration of a specific lysis product during bacteriophage infection. Animal viruses, in contrast, usually cause cell death by inducing apoptosis or programmed cell death. Apoptosis is a suicide pathway in which the mitochrondria cease to function, the cell destroys its DNA, and the cell fragments into small...

Atomic Structure of T3 Viruses

Virus And Atom Photos

Because the simple viruses are regular structures, they will often crystallize, and such crystals may be suitable for X-ray diffraction, Several viruses formed using icosa-hedral symmetry principles have now been solved to atomic resolution, Among T 3 viruses, the structures of FIGURE 2.5 Gallery of three-dimensional reconstructions of icosahedral viruses from cryoelectron micrographs. All virus structures are surface shaded and are viewed along a twofold axis of symmetry. All of the images are...

Family Flaviviridae

The Flaviviridae are so-called from the prototype virus of the genus Flavivirus, yellow fever virus, flavus being the Latin word for yellow. The Flaviviridae are divided into three genera, the genus Flavivirus, the genus Pestivirus, and the genus Hepacivirus. A partial listing of viruses in the three genera is given in Table 3.10. In the discussion below, the term flavivirus refers only to members of the genus Flavivirus, unless otherwise specified. The genome organizations of members of the...

Meaninng Of Tateropox

FIGURE 6.3 Model for the replication of orthopox DNA. Replication is initiated by nicking one strand at the red arrow near the left end of the DNA. This is followed by primer extension and loopback to form an internal primer. Extension then occurs through the hairpin at the right end of the molecule to form a concatemer. Concatemer resolution occurs by nicking at the blue arrows. Parental DNA is shown in blue, new strands in red. Redrawn from data in Moyer and Graves (1981) and Traktman (1990)....

The ICTV Classification of Viruses

The International Committee on Taxonomy of Viruses (ICTV), a committee organized by the Virology Division of the International Union of Microbiological Societies, is attempting to devise a uniform system for the classification and nomenclature of all viruses. Viruses are classified into species on the basis of a close, but not necessarily identical, relationship. The decision as to what constitutes a species is arbitrary because a species usually contains many different strains that may differ...

Receptors for Virus Entry

The infection cycle of an animal virus begins with its attachment to a receptor expressed on the surface of a susceptible cell, followed by penetration of the genome, either naked or complexed with protein, into the cytoplasm. Binding often occurs in several steps. For many viruses, the virion first binds to an accessory receptor that is present in high concentrations on the surface of the cell. These accessory receptors are usually bound with low affinity, and binding often has a large...

Aau Uau X Aaa Uuu Aua Ggg

T-RNA slips on message as mRNA shifts one position to the right FIGURE 1.15 Proposed mechanism of the -1 ribosomal frameshift that occurs in ALV. The slippery sequence is shown in green. The asterisk identifies the UAG codon that terminates the upstream Gag-Pro ORF. Frameshifting is thought to require a pseudoknot downstream of the slippery sequence illustrated in Fig. 1.16 . Adapted from Fields et al. 1996, p. 577 and Goff 1997, p. 156 . virus to fine-tune the processing events, and this...

Vlb

FIGURE 4.20 Ambisence coding strategy of the S RNA of a phlebovirus, family Bunyaviridae, The mRNA for the N protein is synthesized from the S genome segment using primers derived by cap-snatching similar to the mechanism for influenza mRNA priming in Fig, 4,13 from cytoplasmic host mRNAs, The mRNA for the NSs protein is formed in the same way, but with vcRNA as the template, Diagonally striped boxes are the self-complementary termini, The loops in the middle of the viral genomic and...

Family Paramyxoviridae

The family Paramyxoviridae has six genera. These genera are shown in Table 4.3, together with representative viruses in each genus. The relationships among the genera are illustrated in the tree shown in Fig. 4.5. Each genus represents a distinct lineage. Furthermore, Respirovirus, Morbillivirus, Megamyxovirus, and Rubulavirus are more closely related to one another than to Pneumovirus and Metapneumovirus, and the family is divided into two subfamilies, Paramyxovirinae and Pneumovirinae. Many...

U

This is the only example known of a metalloprotease in viruses. Flaviviruses have capped genomes whose translation is cap-dependent. In contrast, the hepacivirus and pestivirus genomes are not capped and have an IRES in the 5' nontrans-lated region. Members of Flaviviridae do not have a poly A tail at the 3' end of the RNA. A stable stem-loop structure present at the 3' end of the Flavivirus genome is illustrated in Fig. 3.20. This structure is required for replication of the genomic RNA...

Does The Yellow Fever Still Exist

Where Does Yellow Fever Still Exist

FIGURE 3.24 Crystal structure ribbon diagram of the dimer of the E protein of tick-borne encephalitis virus. This is a top view, looking down onto the surface of the virion. Numbered sites are those in which mutations alter the virulence of the virus. From Rey et al. 1995 . organ, causes the major symptoms of disease and the symptoms from which the name of the virus derives, jaundice following destruction of liver cells. The virus also replicates in other organs, such as kidney and heart, and...

I

Host DNA polymerase iral-encoded factor FIGURE 1.6 General replication scheme for a DNA virus. After a DNA virus attaches to a cellular membrane receptor, the virus DNA enters the cell and is transported to the cell nucleus. There it is transcribed into mRNA by host RNA polymerase. Viral mRNAs are translated by host ribosomes in the cytoplasm, and newly synthesized viral proteins, both structural and nonstructural, are transported back to the nucleus. After the DNA genome is replicated in the...

Sv40

FIGURE 6.19 Known interactions between the oncogenic proteins shaded with pink patterns of an adenovirus, a polyomavirus, and a papil-lomavirus and cellular proteins that are regulators of cell cycle progression. A Protein E1A of adenoviruses binds to the Rb family, promoting entry into S phase. The 19-kDa form of E1B also binds to p53, blocking apoptosis. B The large T antigen of the polyomavirus, SV40, interacts with the Rb family of proteins as well as with p53 see also Fig. 6.25 . C The...

Viroids And Virusoids

Viroids are small, circular RNA molecules that do not encode any protein and that are infectious as naked RNA molecules. Sequenced viroids range from 246 to 375 nt and possess extensive internal base pairing that results in the RNA being rod-like and about 15 nm long. A partial listing of viroids is given in Table 7.1. All known viroids infect plants. However, hepatitis 8, which infects humans, has many viroid-like properties and may be related to viroids. Many viroids are important...

Ciebov Rebov

Contact with blood or other body fluids Contact with blood or other body fluids Severe hemorrhagic disease Africa Severe hemorrhagic disease Africa disease in monkeys, attenuated in man kidneys were being processed for cell culture production for use in preparing poliovirus vaccine . Twenty-five laboratory workers were infected and six secondary cases resulted of these 31 infected people, 7 died. The monkeys in the shipment, which originated in Uganda, also died. Subsequent studies with the...